rs12974991 chr19:5894573 G>A
- Sequence
agggacggcaggcggcaggcaggc[G/A]cgtgtgcagggggccttatcttat
- ASB in cell types
- R3/R4 erythroid cells CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- NFE2_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFE2_HUMAN | -2.87 | 2.28 | 1.50 | n/a | No Hit | |||
| GATA1_HUMAN | -1.35 | 1.72 | 1.83 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI heart rate response to exercise, heart rate response to recovery post exercise, heart rate variability traits (pvrsa/hf), heart rate variability traits (rmssd)
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Heart_Atrial_Appendage, Pituitary, Skin_Sun_Exposed_Lower_leg