rs12975624 chr19:39844397 G>A
- Sequence
tttcaggtcctggagcttttgggg[G/A]aaaatgtaccaaaagtacccagtc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.42 | -0.16 | 1.99 | |||
| HEK293 (embryonic kidney) | 0.71 | -0.56 | 4.68 | |||
| RWPE1 (prostate epithelial cells) | 1.81 | -1.46 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, obesity with early age of onset (age >2), suicide attempts in bipolar disorder (females)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood