rs12979959 chr19:4576079 C>T
- Sequence
tctgtcccctatccatccactttg[C/T]ccccctctattacccttgcctggc
- ASB in cell types
- LNCaP (prostate carcinoma) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -1.09 | 1.31 | 1.33 | |||
| H929 (plasma cell myeloma) | -3.06 | 2.23 | 2.00 |
Items per page:
1 – 2 of 2