rs12981209 chr19:2900932 C>T
- Sequence
cgagggcgggacgtttcgtcctcc[C/T]tgccgcgcgtgccctgcctaccac
- ASB in cell types
- breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.63 | 1.99 | 2.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, college completion, homa-b, ldl cholesterol, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis