rs13024296 chr2:223725779 G>A
- Sequence
gtcaaagcctccctttctttcaga[G/A]gagtaggaagagaatggcaatggc
- ASB in cell types
- HAEC (human aortic endothelial cells) cranial neural crest cells
- ASB for transcription factors
- JUN_HUMAN COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.20 | 0.15 | 1.61 | n/a | No Hit | |||
| COT1_HUMAN | 1.98 | -1.66 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, transmission distortion