rs13031724 chr2:20597272 C>T
- Sequence
tcacttcctgggccagagtaacca[C/T]ggcaacaccattcccctggcagcc
- ASB in cell types
- GM12878 (female B-cells) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.36 | 1.48 | 1.39 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, hypertension (early onset hypertension), obesity with early age of onset (age >2), refractive error, serum creatinine