rs13033617 chr2:10386254 C>G
- Sequence
agagcccaccatggctccctgttg[C/G]caaatgcagcctgaattcagtatt
- ASB in cell types
- K562 (myelogenous leukemia) SUM159PT (pleiomorphic breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.26 | 0.73 | 1.99 | |||
| SUM159PT (pleiomorphic breast carcinoma) | 1.22 | -0.76 | 1.87 |
Items per page:
1 – 2 of 2