rs1303470 chr14:33393363 G>A
- Sequence
tacaaaaacaggtgccactgattc[G/A]catttttatggatggtgtacatta
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.52 | 0.10 | 1.58 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, arthritis including non-rheumatoid, bipolar disorder, primary rhegmatogenous retinal detachment, response to lithium treatment for bipolar disorder, rheumatoid arthritis, simpson-angus scale, sporadic creutzfeldt-jakob disease, waist hip ratio