rs13044688 chr20:58981914 T>C
- Sequence
tttgggcaaactgatggaaaggat[T/C]ttcgggccttgaccttccagggtt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) LHSAR (prostate epithelial cells) HEK293 (embryonic kidney) K562 (myelogenous leukemia)
- ASB for transcription factors
- ANDR_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -1.76 | 1.97 | 3.00 | n/a | No Hit | |||
| GCR_HUMAN | n/a | 1.87 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, sporadic creutzfeldt-jakob disease, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood