rs13053375 chr22:30356953 C>A
- Sequence
ctggcgcacttccgggaccgtccc[C/A]tcgccgtgacgcgcttcccgcccc
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma) foreskin keratinocyte VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.31 | 1.18 | 1.99 | |||
| HCT-116 (colon carcinoma) | 0.20 | 0.69 | 1.26 | |||
| foreskin keratinocyte | 1.73 | n/a | 2.50 | |||
| VCaP (prostate carcinoma) | 1.29 | 0.12 | 1.75 | |||
| GM12878 (female B-cells) | 0.32 | 0.50 | 1.34 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood