rs13060601 chr3:161105371 G>A
- Sequence
cacgcgccagggccgcggccggaa[G/A]cccctggctgcacgcgcgggccca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF-7 C4-12 (invasive breast ductal carcinoma)
- ASB for transcription factors
- ZFX_HUMAN ELF1_HUMAN MNT_HUMAN MYC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -0.51 | 2.43 | 1.83 | n/a | No Hit | |||
| ELF1_HUMAN | n/a | 2.61 | 1.50 | -2.17 | Discordant | |||
| MNT_HUMAN | -1.91 | 1.97 | 1.33 | n/a | n/a | |||
| MYC_HUMAN | 0.09 | 1.78 | 1.67 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Uterus