rs13155634 chr5:133287731 G>A
- Sequence
cccgcactctgctctaggatgaca[G/A]cagtgccgtttcttgaatgtattc
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) VCaP (prostate carcinoma) GM12878 (female B-cells)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | -3.12 | 2.29 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, late onset alzheimers disease, microalbuminuria, urinary albumin-to-creatinine ratio