rs13162208 chr5:115381354 G>A
- Sequence
catgttttagcagcaactactggc[G/A]tttcctctttctcttagtagctga
- ASB in cell types
- periferal blood macrophages monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | -0.69 | 1.72 | 2.00 | |||
| monocyte-derived dendritic cells | n/a | 2.62 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, hdl cholesterol, height