rs1320645 chr11:76659044 C>A
- Sequence
ttttcagagagactgaaagtcatt[C/A]tcagaagacgtgacaaacagtctg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- LMBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LMBL2_HUMAN | 2.04 | 0.23 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood