rs13225906 chr7:114928049 A>G
- Sequence
aggatttgggaacattttgaattt[A/G]gaaaatgaatcttagaacttatac
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.34 | 0.66 | 1.31 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hypertension (early onset hypertension), maternal transmission distortion, microalbuminuria, resistance to kuru in aged women despite likely exposure, tetrology of fallot, total cholesterol, transmission distortion