rs13242357 chr7:158696348 G>A
- Sequence
tgaaggccacttcctcaatattcc[G/A]tccgtcaaagcaggcacaagccca
- ASB in cell types
- foreskin keratinocyte monocyte-derived dendritic cells HEK293 (embryonic kidney) coronary artery
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.75 | 2.43 | 2.00 | |||
| monocyte-derived dendritic cells | n/a | 1.15 | 2.50 | |||
| HEK293 (embryonic kidney) | -0.22 | 0.81 | 1.97 | |||
| coronary artery | 1.51 | -1.42 | 1.00 |
Items per page:
1 – 4 of 4