rs13250 chr7:44986581 G>A
- Sequence
gcccaggatggcggtggatgacta[G/A]actgccgaagaccgcgccgctgcg
- ASB in cell types
- neural cell MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- MYC_HUMAN MXI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYC_HUMAN | 0.28 | 1.09 | 1.57 | n/a | No Hit | |||
| MXI1_HUMAN | -0.85 | 0.85 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis, Whole_Blood