rs132549 chr22:28922736 C>T
- Sequence
tgaacacacctagcagtcctggcc[C/T]atgtccgtttcccagttaactctt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.33 | 0.45 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), amyotrophic lateral sclerosis (als) age of onset, birth weight, childhood acute lymphoblastic leukemia, primary rhegmatogenous retinal detachment, triglycerides, waist hip ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Pancreas, Pituitary, Testis, Thyroid