rs13264229 chr8:140438862 T>G
- Sequence
cgtgccaccacgcccagctaattt[T/G]tgtatttttagtagagacgtggtt
- ASB in cell types
- macrophages
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -3.08 | 2.33 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Colon_Transverse, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid