rs13264489 chr8:71924194 T>G
- Sequence
catctggagaccgactaggcttag[T/G]gggagctgcaaaggaaatgatctg
- ASB in cell types
- GM12878 (female B-cells) macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.47 | 0.73 | 1.30 | |||
| macrophages | n/a | 1.80 | 2.50 |
Items per page:
1 – 2 of 2