rs13265432 chr8:125472467 G>A
- Sequence
aacatcttgcctctcacacaggcc[G/A]tattgctcctgcaattctaatccg
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.91 | 1.06 | 1.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, coronary artery disease (cad), hdl cholesterol, height, ldl cholesterol, parkinsons disease, serum creatinine, total cholesterol, triglycerides