rs1327474 chr6:137219938 C>T
- Sequence
caattcagtgtcaaatcagtttat[C/T]aggcagcctctcatgaagaggtct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 1.80 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), irritible bowel syndrome, longevity (time to mortality), rheumatoid arthritis, tetrology of fallot, total cholesterol, triglycerides