rs133015 chr22:38176519 C>G
- Sequence
gcagaacctggcagcagtgacacc[C/G]tcctgagcaccctcctcccaccca
- ASB in cell types
- GM12878 (female B-cells) SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.54 | 0.13 | 1.28 | |||
| SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive) | -1.26 | 1.23 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, body mass index (bmi), hdl cholesterol, height, infant head circumference, ldl cholesterol, myopia, serum creatinine, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood