rs1332633 chr1:62032469 C>T
- Sequence
aactgataatctccctttatctta[C/T]agtcagctgtgacttatcatatag
- ASB in cell types
- HUES64 (embryonic stem cells)
- ASB for transcription factors
- GATA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA4_HUMAN | 1.26 | -0.89 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, ldl cholesterol, ldl cholesterol change with statins, tetrology of fallot, total cholesterol, total cholesterol change with statins, triglycerides, years of education