rs1337009 chr9:70925353 C>A
- Sequence
ataaataatgaatcaccaccctac[C/A]gcaatgatgtattacactagactt
- ASB in cell types
- NB69 (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NB69 (neuroblastoma) | -1.65 | 1.98 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, hdl cholesterol