rs13402 chr12:6753008 C>G
- Sequence
cccggtacgctgcagggtcagggt[C/G]gcggcccggaacgtggggattggt
- ASB in cell types
- breast tumor tissue CD14+ monocytes foreskin keratinocyte
- ASB for transcription factors
- ESR1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.33 | -2.17 | 2.00 | 2.76 | Discordant | |||
| STAT1_HUMAN | 1.60 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
