rs13431833 chr2:217512891 G>A
- Sequence
gcatacacacatacacatgcatac[G/A]ccatacaaatgcatacacatacac
- ASB in cell types
- HepG2 (hepatoblastoma) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.12 | -0.21 | 2.00 | |||
| pancreas | 1.52 | -1.57 | 1.00 |
Items per page:
1 – 2 of 2