rs135167 chr22:37033088 C>T
- Sequence
tcccaaccttgcctaaccagctgc[C/T]ctggaatgttttccacttcctggg
- ASB for transcription factors
- ESR1_HUMAN GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.69 | 0.49 | 1.51 | n/a | No Hit | |||
| GRHL2_HUMAN | 0.01 | 0.78 | 1.38 | 1.38 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP college completion, hematocrit (hct), hemoglobin (hb), ldl cholesterol, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), microalbuminuria, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid