rs1361812 chr1:101474133 T>G
- Sequence
gaaaggctaaggaatgcttacatg[T/G]gatttccaaggccaactatcaaca
- ASB in cell types
- PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | -0.04 | 1.72 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, cognitive response of healthy volunteers to topiramate treatment as measure by the trailsa cognitive test, comorbid depressive syndrome and alcohol dependence, neuroblastoma (brain cancer), spine bone mineral density (bmd)