rs136343 chr22:30755548 T>C
- Sequence
agcagcttccgaagtgtaggcctc[T/C]tttgacttcgggaagctttgtctt
- ASB in cell types
- PC9 (lung adenocarcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | -1.18 | 2.64 | 3.00 | |||
| GM12878 (female B-cells) | 0.53 | 0.52 | 1.30 |
Items per page:
1 – 2 of 2