rs136496 chr22:26836086 G>A
- Sequence
gggattctgggtcagggttgcctc[G/A]tctgtaaaatggggataattccca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.07 | 0.09 | 1.75 | |||
| erythroid progenitors | -3.71 | 2.24 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid