rs1365201 chr8:94642495 T>C
- Sequence
ggcgctgtggcgtagacgtgcagg[T/C]gggcccggcgggtgtgcaagaagt
- ASB in cell types
- keratinocytes upper lobe of left lung K562 (myelogenous leukemia) thyroid gland
- ASB for transcription factors
- CTCF_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.60 | 1.31 | 1.63 | n/a | No Hit | |||
| SNAI2_HUMAN | 1.90 | -1.82 | 1.50 | -4.31 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
