rs1366544 chr16:56930807 G>A
- Sequence
cccatcatcaggcattcgattctc[G/A]taaggagcacagcctagttccctt
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.16 | 0.68 | 1.77 | |||
| K562 (myelogenous leukemia) | 0.55 | -0.29 | 2.18 |
Items per page:
1 – 2 of 2