rs1374188 chr2:37982256 G>T
- Sequence
gaagtacaaaccatttcctcaaag[G/T]agacctcttttttcactctgccac
- ASB in cell types
- CD34+ stem cells-derived erythroblasts HEK293 (embryonic kidney) HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | n/a | 2.97 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.63 | 0.57 | 1.34 | |||
| HUES64 (embryonic stem cells) | 0.78 | -0.03 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Minor_Salivary_Gland, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid