rs137618 chr22:39309099 C>T
- Sequence
gtttcaggaatccacggggggtgt[C/T]ggagggtaggggctactgtaattt
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | -3.84 | 1.91 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP eye color, hdl cholesterol, hip bone mineral density (bmd), irritible bowel syndrome, schizophrenia
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Liver, Pancreas, Pituitary, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood