rs137685 chr22:39343623 C>T
- Sequence
ctgaaatacggtgaatgcatctcc[C/T]ttctgttcacgcaactccaacttc
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.16 | 0.74 | 1.97 | |||
| GM12878 (female B-cells) | 0.38 | 0.66 | 1.27 | |||
| CD34+ stem cells-derived erythroblasts | 2.02 | -3.95 | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Heart_Left_Ventricle, Liver, Nerve_Tibial, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood