rs1379707 chr4:80259225 C>T
- Sequence
acttagtggcttcactgacaggtg[C/T]ttctctgttttaccagacaacagg
- ASB in cell types
- keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | n/a | 2.91 | 1.50 | -1.80 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), eye color, hair morphology, ldl cholesterol, ldl cholesterol change with statins, microalbuminuria, neuroblastoma (brain cancer), serum creatinine, systolic blood pressure (sbp), total cholesterol change with statins, years of education