rs139042 chr22:43274088 G>A
- Sequence
ccaggctggtcactaggtgtcacc[G/A]caatcaagtttttctgcccccacg
- ASB in cell types
- normal lung fibroblasts CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.54 | 1.30 | 1.38 | 0.22 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, ldl cholesterol, mitral annular calcium, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio