rs1391221 chr11:86244237 G>C
- Sequence
gcactttggctgtaactcattgga[G/C]tctagtctcataatgttaggatat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HeLa S3 (cervical adenocarcinoma) GM12878 (female B-cells) HEK293 (embryonic kidney)
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | n/a | 1.96 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1