rs1397933 chr4:40185917 T>G
- Sequence
cacaaacatgttttcctctaatga[T/G]cctcaagcatttcccactacctct
- ASB in cell types
- germinal center B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center B-cells | 1.12 | 2.02 | 2.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi) in type 2 diabetes, myocardial infarction (mi), sudden cardiac arrest in patients with coronary artery disease (cad), neuroblastoma (brain cancer), parkinsons disease, prostate cancer, rheumatoid arthritis, stabilized warfarin dose, weight in type 2 diabetes