rs14059 chr9:7799606 C>A
- Sequence
gcgacagctccagcaggtcttcaa[C/A]aggcggtgttctgctggggaggtc
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-BR-3 (breast adenocarcinoma) | -0.91 | 1.10 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), fasting insulin, homa-b, homa-ir, hypertension (early onset hypertension), refractive error
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum