rs1409273 chr10:20858441 T>A
- Sequence
catacatcataaagtaggactatt[T/A]agtggtaaatggacagacgaattt
- ASB in cell types
- GM12878 (female B-cells) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.65 | 0.37 | 1.33 | |||
| K562 (myelogenous leukemia) | 0.35 | -0.01 | 1.99 |
Items per page:
1 – 2 of 2