rs14158 chr19:11131368 G>A
- Sequence
cagaacccttcctgagacctcgcc[G/A]gccttgttttattcaaagacagag
- ASB in cell types
- SK-N-SH (neuroblastoma) HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | -1.55 | 1.35 | 1.33 | |||
| HEK293 (embryonic kidney) | 0.42 | -0.26 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.46 | -0.13 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Testis, Thyroid, Whole_Blood