rs1416545 chr6:72412287 G>A
- Sequence
ctcactctgccacactagcatttg[G/A]ctcaaaattatgaacaagggtttg
- ASB in cell types
- epidermal keratinocytes GM12878 (female B-cells) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.25 | -1.81 | 2.00 | |||
| GM12878 (female B-cells) | 0.41 | 0.50 | 1.33 | |||
| VCaP (prostate carcinoma) | -0.31 | 0.82 | 2.00 |
Items per page:
1 – 3 of 3