rs1418191 chr1:173393318 T>C
- Sequence
acgtgtgagtcattcgtgacattt[T/C]ctcaccctcactcaacatactttg
- ASB in cell types
- SK-N-SH (neuroblastoma) HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -2.59 | 1.80 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, irritible bowel syndrome, rheumatoid arthritis, systolic blood pressure (sbp)