rs1421896 chr5:141636721 T>G
- Sequence
ccgtgtcccaacccctcatgcata[T/G]ccctgtttcctcaccgtagtggaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -0.91 | 1.64 | 1.92 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid