rs14236 chr13:20489385 A>G
- Sequence
ttcactcacctgaatgtgcatggc[A/G]ccctctactgcttcttggatattg
- ASB in cell types
- H1 (embryonic stem cells) heart left ventricle LNCaP (prostate carcinoma) 786-O (renal carcinoma)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -1.05 | 2.05 | 2.40 | 3.30 | Concordant | |||
| RAD21_HUMAN | -1.02 | 2.63 | 2.00 | n/a | n/a | |||
| SNAI2_HUMAN | n/a | 1.80 | 1.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Minor_Salivary_Gland, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood