rs1429076 chr16:11783499 A>G
- Sequence
ttccttgtcttgtgattgcaggac[A/G]ttggcagtatttctgcctctaccc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.38 | 0.89 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.58 | -0.32 | 1.94 |
Items per page:
1 – 2 of 2