rs143090928 chr15:34437822 C>G
- Sequence
agctgaatagcggcgggagcctac[C/G]gcgagcggagtacggaaagcccgc
- ASB in cell types
- tibial nerve HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | 1.76 | -1.38 | 1.33 | |||
| HCT-116 (colon carcinoma) | 1.18 | -1.18 | 1.17 |
Items per page:
1 – 2 of 2