rs1432561 chr2:55961513 G>T
- Sequence
gtagctgccctcttgtggtcaaat[G/T]gaaagttttgcctctttgtcttaa
- ASB in cell types
- A549 (lung carcinoma) HeLa Kyoto (cervical adenocarcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.59 | 0.35 | 1.19 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -0.42 | 1.20 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | -0.57 | 1.40 | 2.00 |
Items per page:
1 – 3 of 3